Full Text Journal Articles by
Author Zhou Cai

Advertisement

Find full text journal articles








Magnon-tuning non-volatile magnetic dynamics in a CoZr/PMN-PT structure.

Cai Zhou, Ming-Fang Zhang, Fu-Fu Liu, Ying Jin, Chang-Jun Jiang, Min Hu, Cun-Fang Feng, Feng-Long Wang, Ming-Yao Xu, Sheng-Xiang Wang,

Magnon-tuning non-volatile magnetic dynamics is investigated in a CoZr/PMN-PT structure by measuring ferromagnetic resonance at room temperature. The electric-field control of ferromagnetic resonance shows loop-like behavior, which indicates non-volatile electric-field control of the magnetism. Further, fitting the curves of in-plane rotating angle versus ferromagnetic resonance field under different electric fields ... Read more >>

Sci Rep (Scientific reports)
[2020, 10(1):14347]

Cited: 0 times

View full text PDF listing >>



NLR combined with SaO2 predict severe illness among COVID-19 patients: a currently updated model

Zili Zhang, Xiansheng Zeng, Jian Wang, Guo, Minglong Fu, Xuejiao Yang, Yun Bai, Qiaoxin Huang, Zhuowei Li, Jingyi Xu, Yuanyuan Li, Xiaodan Zhang, Fei Liu, Liang Yuan, Xiaohui Xie, Qiongqiong Li, Bingxian Deng, Lingzhu Chen, Yongxuan Gao, Lan Wang, Zhou Cai, Zhanbei Zhu, Fanjie Lin, Wei Liu, Hua Guo, Qinghui Huang, Nanshan Zhong, Wenju Lu,

Abstract Objectives: The pandemic of the coronavirus disease 2019 (COVID-19) continuously poses a serious threat to public health, highlighting an urgent need for simple and efficient early detection and prediction. Methods: We comprehensively investigated and reanalyzed the published indexes and models for predicting severe illness among COVID‑19 patients in our ... Read more >>

()
[, :]

Cited: 0 times

View full text PDF listing >>



Advertisement

LncRNA SENCR suppresses abdominal aortic aneurysm formation by inhibiting smooth muscle cells apoptosis and extracellular matrix degradation.

Zhou Cai, Jianhua Huang, Junxiao Yang, Baihong Pan, Wei Wang, Yangyang Ou, Xianwei Wang, Pu Yang,

Abdominal aortic aneurysm (AAA) is a progressive chronic dilatation of the abdominal aorta without effective medical treatment. This study aims to clarify the potential of long non-coding RNA SENCR as a treatment target in AAA. Angiotensin II (Ang-II) was used to establish AAA mouse model as well as a cell ... Read more >>

Bosn J Basic Med Sci (Bosnian journal of basic medical sciences)
[2020, :]

Cited: 0 times

View full text PDF listing >>



Effects of programmed cell death protein 10 on fecundity in Schistosoma japonicum.

Yan-Ru Gao, Ji-Hong Xu, Chun-Lian Tang, Zhou Cai, Qiong Wu, Ying Xiong, Li-Xia Wang,

Programmed cell death protein 10 (PCDP10) is widely distributed in animal tissues and exerts extensive biological effects. This study aimed to investigate the effect of Schistosoma japonicum PCDP10 (SjPCDP10) on the fecundity of schistosomes. We performed real-time PCR to assess Sjpcdp10 expression levels at different developmental stages of S. japonicum. ... Read more >>

Parasitol. Res. (Parasitology research)
[2020, 119(4):1317-1325]

Cited: 0 times

View full text PDF listing >>



Solvent Engineering of a Dopant-Free Spiro-OMeTAD Hole-Transport Layer for Centimeter-Scale Perovskite Solar Cells with High Efficiency and Thermal Stability.

Min Hu, Xuelian Wu, Wen Liang Tan, Boer Tan, Andrew D Scully, Lei Ding, Cai Zhou, Yuli Xiong, Fuzhi Huang, Alexandr N Simonov, Udo Bach, Yi-Bing Cheng, Shengxiang Wang, Jianfeng Lu,

High efficiency and environmental stability are mandatory performance requirements for commercialization of perovskite solar cells (PSCs). Herein, efficient centimeter-scale PSCs with improved stability were achieved by incorporating an additive-free 2,2',7,7'-tetrakis[N,N-di(p-methoxyphenyl)amino]-9,9'-spirobifluorene (spiro-OMeTAD) hole-transporting material (HTM) through simply substituting the usual chlorobenzene solvent with pentachloroethane (PC). A stabilized power conversion efficiency (PCE) ... Read more >>

ACS Appl Mater Interfaces (ACS applied materials & interfaces)
[2020, 12(7):8260-8270]

Cited: 0 times

View full text PDF listing >>



Hydrogen sulfide inhibits cigarette smoke-induced inflammation and injury in alveolar epithelial cells by suppressing PHD2/HIF-1α/MAPK signaling pathway.

Ruijuan Guan, Jian Wang, Defu Li, Ziying Li, Hanwei Liu, Mingjing Ding, Zhou Cai, Xue Liang, Qian Yang, Zhen Long, Lingzhu Chen, Wei Liu, Dejun Sun, Hongwei Yao, Wenju Lu,

Chronic obstructive pulmonary fibrosis (COPD) is a chronic and fatal lung disease with few treatment options. Sodium hydrosulfide (NaHS), a donor of hydrogen sulfide (H2S), was found to alleviate cigarette smoke (CS)-induced emphysema in mice, however, the underlying mechanisms have not yet been clarified. In this study, we investigated its ... Read more >>

Int. Immunopharmacol. (International immunopharmacology)
[2020, 81:105979]

Cited: 0 times

View full text PDF listing >>



Magnon-driven interfacial magnetoelectric coupling in Co/PMN-PT multiferroic heterostructures.

Cai Zhou, Mingfang Zhang, Cunfang Feng, Mingyao Xu, Shengxiang Wang, Changjun Jiang,

Magnon-driven interfacial magnetoelectric coupling in Co/PMN-PT multiferroic heterostructures is investigated at room temperature. The electric field controlled ferromagnetic resonance field possesses a loop-like curve, with a large resonance field shift between positive and negative remanent polarizations, which confirms a non-volatile strong magnetoelectric coupling. However, with a non-magnetic Ta layer inserted ... Read more >>

Phys Chem Chem Phys (Physical chemistry chemical physics : PCCP)
[2019, 21(38):21438-21444]

Cited: 0 times

View full text PDF listing >>



Identification of key microRNAs and genes associated with abdominal aortic aneurysm based on the gene expression profile.

Pu Yang, Zhou Cai, Kai Wu, Yu Hu, Ling Liu, Mingmei Liao,

NEW FINDINGS:What is the central question of this study? The aim was to identify abdominal aortic aneurysm (AAA)-associated microRNAs and their target genes in AAA using microarray analysis. What is the main finding and its importance? The main finding was that miR-145 and miR-30c-2* were found to be downregulated microRNAs ... Read more >>

Exp Physiol (Experimental physiology)
[2020, 105(1):160-173]

Cited: 1 time

View full text PDF listing >>



Bax inhibitor-1 overexpression in prelimbic cortex protects rats against depression-like behavior induced by olfactory bulbectomy and reduces apoptotic and inflammatory signals.

Dao Li, Zhou Cai, Ji Wu, Yan Zhang,

BACKGROUND AND PURPOSE:Depression is a mental disorder characterized by a pervasive low mood and loss of pleasure or interest in usual activities, and often results in the impairment of learning and memory. Bax inhibitor-1 (BI-1) has been reported to be involved in the pathological mechanisms for neurodegenerative disorders including depression. ... Read more >>

Neurol. Res. (Neurological research)
[2019, 41(4):369-377]

Cited: 0 times

View full text PDF listing >>



Electric-field control of non-volatile 180° switching of the unidirectional anisotropy field in a multiferroic heterostructure.

Pingping Li, Cai Zhou, Cuimei Cao, Wenqiang Wang, Changjun Jiang,

We investigate the room-temperature, electric-field-mediated, non-volatile 180° switching of the unidirectional anisotropy field in an IrMn/CoFeB/Ta/Pb(Mg1/3Nb2/3)O3-PbTiO3 heterostructure. The variation in exchange bias under different electric fields appears clearly in the magnetic hysteresis loops. The remnant magnetization as a function of electric field, as determined by static magnetic measurements, exhibits a ... Read more >>

Phys Chem Chem Phys (Physical chemistry chemical physics : PCCP)
[2018, 20(40):25854-25860]

Cited: 0 times

View full text PDF listing >>



In-Fiber Mach-Zehnder Interferometer Based on Three-Core Fiber for Measurement of Directional Bending.

Lei Ding, Yu Li, Cai Zhou, Min Hu, Yuli Xiong, Zhongliang Zeng,

A highly sensitive directional bending sensor based on a three-core fiber (TCF) Mach-Zehnder interferometer (MZI) is presented in this study. This MZI-based bending sensor was fabricated by fusion-splicing a section of TCF between two single-mode fibers (SMF) with core-offset. Due to the location of the core in the TCF, a ... Read more >>

Sensors (Basel) (Sensors (Basel, Switzerland))
[2019, 19(1):]

Cited: 0 times

View full text PDF listing >>



Enhanced expression of SRPK2 contributes to aggressive progression and metastasis in prostate cancer.

Yang Jia Zhuo, Ze Zhen Liu, Song Wan, Zhi Duan Cai, Jian Jiang Xie, Zhou da Cai, Sheng da Song, Yue Ping Wan, Wei Hua, Wei de Zhong, Chin Lee Wu,

Serine/Arginine-Rich Protein-Specific Kinase-2 (SRSF protein kinase-2, SRPK2) is up-regulated in multiple human tumors. However, the expression, function and clinical significance of SRPK2 in prostate cancer (PCa) has not yet been understood. We therefore aimed to determine the association of SRPK2 with tumor progression and metastasis in PCa patients in our ... Read more >>

Biomed. Pharmacother. (Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie)
[2018, 102:531-538]

Cited: 6 times

View full text PDF listing >>



Electric Field Tuning Non-volatile Magnetism in Half-Metallic Alloys Co2FeAl/Pb(Mg1/3Nb2/3)O3-PbTiO3 Heterostructure.

Gesang Dunzhu, Fenglong Wang, Cai Zhou, Changjun Jiang,

We reported the non-volatile electric field-mediated magnetic properties in the half-metallic Heusler alloy Co2FeAl/Pb(Mg1/3Nb2/3)O3-PbTiO3 heterostructure at room temperature. The remanent magnetization with different applied electric field along [100] and [01-1] directions was achieved, which showed the non-volatile remanent magnetization driven by an electric field. The two giant reversible and stable ... Read more >>

Nanoscale Res Lett (Nanoscale research letters)
[2018, 13(1):75]

Cited: 1 time

View full text PDF listing >>



Management of Progressive Pulmonary Nodules Found during and outside of CT Lung Cancer Screening Studies.

Mathias Meyer, Rozemarijn Vliegenthart, Thomas Henzler, Daniel Buergy, Frank A Giordano, Michael Kostrzewa, Nils Rathmann, Odd Terje Brustugun, Lucio Crino, Anne-Marie C Dingemans, Michael Dusmet, Dean Fennell, Dominique Grunenwald, Rudolf Maria Huber, Marcin Moniuszko, Francoise Mornex, Mauro Papotti, Lothar Pilz, Suresh Senan, Kostas Syrigos, Maurice Pérol, Jhanelle E Gray, Christoph Schabel, Jan P van Meerbeeck, Nico van Zandwijk, Cai Cun Zhou, Christian Manegold, Wieland Voigt, Eric Dominic Roessner,

Although the effectiveness of screening for lung cancer remains controversial, it is a fact that most lung cancers are diagnosed at an advanced stage outside of lung cancer screening programs. In 2013, the U.S. Preventive Services Task Force revised its lung cancer screening recommendation, now supporting lung cancer screening by ... Read more >>

J Thorac Oncol (Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer)
[2017, 12(12):1755-1765]

Cited: 1 time

View full text PDF listing >>



Electric field control of magnetization reorientation in Co/Pb (Mg1/3Nb2/3)-PbTiO3 heterostructure.

Fenglong Wang, Cai Zhou, Dunzhu Gesang, Changjun Jiang,

Herein, we demonstrated an apparent electric field control of magnetization reorientation at room temperature, through a strain-mediated magnetoelectric coupling in ferromagnetic/ferroelectric (FM/FE) multiferroic heterostructure. As the applied electric field increased, the magnetization tended to deviate from the original direction, which was induced by nonlinear strain vs electric-field behavior from the ... Read more >>

Nanoscale Res Lett (Nanoscale research letters)
[2017, 12(1):104]

Cited: 1 time

View full text PDF listing >>



[Sexual size dimorphism and female individual fecundity of Saurogobio dabryi in the lower reaches of the Jialing River, Southwest China.]

Yue Hu, Yu Zeng, Zhao Ming Jiang, Cai Quan Zhou,

To investigate the sexual morphological differences and female individual fecundity of Saurogobio dabryi, the sexual size dimorphism, sex ratio and female individual fecundity of 76 individuals collected from the lower reaches of the Jialing River (Hechuan section) in breeding season were analyzed. The results showed that the sex ratio of ... Read more >>

Ying Yong Sheng Tai Xue Bao (Ying yong sheng tai xue bao = The journal of applied ecology)
[2017, 28(2):658-664]

Cited: 0 times

View full text PDF listing >>



[Odorants Removal and Microbial Characteristics in Treatment of Micro-polluted Source Water with Biological Powdered Activated Carbon-Ultrafiltration Combined Process].

Yong-Qi Xuan, Li Zhou, Hui-Ping Deng, Zhou Cai, Da-Peng Li, Gang Liu,

The odorants in simulated micro-polluted source water were removed by the Biological Powdered Activated Carbon-Ultrafiltration (BPAC-UF) combined process, and variations of microorganisms in the combined process were discussed. Compared with the conventional process of coagulation and sedimentation, BPAC-UF combined process had better performance in controlling odorants in micro-polluted source water. ... Read more >>

Huan Jing Ke Xue (Huan jing ke xue= Huanjing kexue)
[2016, 37(10):3864-3869]

Cited: 0 times

View full text PDF listing >>



Atypical chemokine receptor D6 inhibits human non-small cell lung cancer growth by sequestration of chemokines.

Feng Ying Wu, Jiang Fan, Liang Tang, Yin Min Zhao, Cai Cun Zhou,

Chemokines and their receptors have been shown to play a vital role in lung cancer progression. D6 is an atypical chemokine receptor which is able to internalize and degrade chemokines. To investigate the potential role of D6 in lung cancer, we established D6-overexpressing A549 lung cancer cell lines by the ... Read more >>

(Oncology letters)
[2013, 6(1):91-95]

Cited: 11 times

View full text PDF listing >>



Sexual size dimorphism in anurans fails to obey Rensch's rule.

Wen Bo Liao, Yu Zeng, Cai Quan Zhou, Robert Jehle,

BACKGROUND:Sexual size dimorphism (SSD) is related to ecology, behaviour and life history of organisms. Rensch's rule states that SSD increases with overall body size in species where males are the larger sex, while decreasing with body size when females are larger. To test this rule, we analysed literature as well ... Read more >>

(Frontiers in zoology)
[2013, 10(1):10]

Cited: 13 times

View full text PDF listing >>



Reduced miR-100 expression in cervical cancer and precursors and its carcinogenic effect through targeting PLK1 protein.

Bao Hua Li, Jian Song Zhou, Feng Ye, Xiao Dong Cheng, Cai Yun Zhou, Wei Guo Lu, Xing Xie,

AIM: Although aberrant miRNAs expression has been documented, altered miR-100 expression in cervical cancer and precursor tissues and its carcinogenic effect and mechanism remain unexplored. The aim of our study was to investigate the role of miR-100 alteration in cervical carcinogenesis. METHODS: The expression of miR-100 was examined by quantitative ... Read more >>

Eur. J. Cancer (European journal of cancer (Oxford, England : 1990))
[2011, 47(14):2166-2174]

Cited: 54 times

View full text PDF listing >>



Identification of glia maturation factor beta as an independent prognostic predictor for serous ovarian cancer.

Yan Li Li, Feng Ye, Xiao Dong Cheng, Ying Hu, Cai Yun Zhou, Wei Guo Lü, Xing Xie,

Serous ovarian carcinoma (SOC) is the most common subtype of epithelial ovarian cancer which remains the leading cause of death from gynaecologic malignancy. Further knowledge of the proteins involved in serous ovarian cancer may lead to new treatment targets, new markers for early detection or prognosis prediction. In this study, ... Read more >>

Eur. J. Cancer (European journal of cancer (Oxford, England : 1990))
[2010, 46(11):2104-2118]

Cited: 24 times

View full text PDF listing >>



Treatment of advanced non-small-cell lung cancer with Chinese herbal medicine by stages combined with chemotherapy.

Zhen Ye Xu, Chang Juan Jin, Cai Cun Zhou, Zhong Qi Wang, Wei Dong Zhou, Hai Bin Deng, Ming Zhang, Wan Su, Xiao Yue Cai,

To observe the effect of Chinese herbal medicine by stages combined with chemotherapy in treating patients with non-small-cell lung cancer (NSCLC) of stage III or IV.Adopting prospective, randomized, controlled, multi-centered trial design, 121 patients enrolled were assigned to the treatment group (n = 65) and the control group (n = 56). All the patients ... Read more >>

J. Cancer Res. Clin. Oncol. (Journal of cancer research and clinical oncology)
[2011, 137(7):1117-1122]

Cited: 16 times

View full text PDF listing >>



Method for detecting COL7A1 gene mutation and uses thereof

XIANG REN, QING WANG, MUGEN LIU, JINGYU LIU, QI YAO, ZHOU CAI, XIAOHUA DAI,

The invention discloses a method of detecting 26311 Mutation of COL7A1 gene and a usage thereof. The method adopts primers of p87F (TGGGCCTGAAATATGAGGAG) and P87R (TAGGCCACTGGAGAGACAGG) to PCR-amplify COL7A1 gene including the section of 26251-26350, implements the sequence after the purification of products, or uses BslI for the endonuclease detection ... Read more >>

()
[, :]

Cited: 0 times

View full text PDF listing >>



A novel heterozygous mutation in the Indian hedgehog gene (IHH) is associated with brachydactyly type A1 in a Chinese family.

Mugen Liu, Xu Wang, Zhou Cai, Zhaohui Tang, Kangsheng Cao, Bo Liang, Xiang Ren, Jing Yu Liu, Qing K Wang,

Brachydactyly type A1 (BDA1) is caused by mutations in the Indian hedgehog gene, IHH, on chromosome 2q35-36. In this study, a large five-generation Chinese family with BDA1 was identified and characterized. All affected family members demonstrated significant homogeneous phenotype and some unique clinical features different from those associated with the ... Read more >>

J. Hum. Genet. (Journal of human genetics)
[2006, 51(8):727-731]

Cited: 16 times

View full text PDF listing >>



[An anti-tumor research of recombinant phage vaccine expressed xenogenic EGFR].

Xian Zhuo Zeng, Dong Liu, Liang Tang, Cai Cun Zhou, Li Song Tan, Xin Hua Cai, Xiao Wen Li, Jun Nian Zhou, Pei De Zhang, Shang Quan Zhang,

A recombinant phage vaccine expressing EGFR on it's capsid was constructed and used to study the anti-tumor effect. The T7 phage display system was applied to display seven xenogenic (human, chicken) epidermal growth factor receptor extracellular domain fragments. The EGFR fragment was expressed as fused protein with 10B capsid on ... Read more >>

Shi Yan Sheng Wu Xue Bao (Shi yan sheng wu xue bao)
[2005, 38(6):481-489]

Cited: 0 times

View full text PDF listing >>





Advertisement

Disclaimer
1.0232 s